fortniteplayer6969 fortniteplayer6969

03-04-2021
History

contestada

hahahaha

u better die!!!

heres a binary language

01001010 01001111 01010010 01000100 01001001 01000101

hahahahau better dieheres a binary language 01001010 01001111 01010010 01000100 01001001 01000101 class=

Respuesta :

ozzybunns ozzybunns

03-04-2021

Answer:

uhhhh what? I'm so confused lol

Answer Link

IcyPolo IcyPolo

03-04-2021

Imagine playing fortnite ‍♂️

Answer Link

Otras preguntas

find x. problem is in picture

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Two point charges are fixed on the y axis: a negative point charge q1 = -28 µC at y1 = +0.21 m and a positive point charge q2 at y2 = +0.36 m. A third point cha

What is the angular acceleration if the weight is 24.0 cm from the elbow joint, her forearm has a moment of inertia of 0.240 kg⋅m2, and the net force she exerts

Evaluate 7C3 OA) 25 O B) 45 OC) 35 OD) 20

What does molarity tell us that percent solution information does not tell us?

Gabuat Corporation, which has only one product, has provided the following data concerning its most recent month of operations Selling price $ 106 Units in be

I FAILED! Find the correct result. 1+4=5 2+5=12 3+6=21 5+8=_________ If your answer is wrong, you must upload it on your timeline. GAME? If your answer is wrong

While conducting a survey of biodiversity in Guam, you discover a rare plant with large, conspicuous conelike reproductive structures that are red in color. Tak

Find the solution(s) to the system of equations. y= x^2 -2x -3 y= x -3