tavarezl tavarezl

03-02-2021
Computers and Technology

contestada

Refer to the image on the right. Then, using the drop-down menu, identify the port. HDMI, FireWire, Ethernet, USB

Refer to the image on the right Then using the dropdown menu identify the port HDMI FireWire Ethernet USB class=

Respuesta :

letsgobaby77 letsgobaby77

10-02-2021

Answer:

HDMI

Explanation:

Answer Link

Otras preguntas

Purpose of this project is to increase your understanding of data, address, memory contents, and strings. You will be expected to apply selected MIPS assembly l

The area of a triangular sail is given by the expression 1 2 bh, where b is the length of the base and h is the height. What is the area of a triangular sail in

Members of the ________ perform many duties, from rescuing people and patrolling harbors to working with environmental groups to protect ocean animals

SOMEONE PLEASE HELP ME ANSWER THESE! QUESTION 8 Qui dirigeaient ces terres en 1660? Des hommes. Des veuves. Des français. Des indiens. QUESTION 9 Le roi de la F

Select all the offspring phenotypes that could be produced from a BbEE x bbee cross (shown above). black fur, red eyes black fur, black eyes white fur, black ey

1) A drought a. Can occur quickly b. Can easily be predicted c. Takes a long time to develop d. B and C are correct 4) Droughts a. Can easily be prevented and s

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

A main difference between organisms with simple body plans and those with complex body plans is that A main difference between organisms with simple body plans

Even though opinions vary widely, the kingdom Protista is understood to consist of three general groups. Use your textbook (pg. 401–409) and the web sites below

we started something new and I'm competely lost