somaiasult2006 somaiasult2006

02-01-2019
Mathematics

contestada

I don't this question so I need help with this problem

I dont this question so I need help with this problem class=

Respuesta :

Аноним Аноним

02-01-2019

So first divide 7,500 by 150 and you will get 50.Next,do 17X50 which will give you 850.The answer is 850 Gold beads.Hope that helped.Have a happy new year

Answer Link

Otras preguntas

The federal government's insurance program for the elderly and disabled is called:

List and briefly describe each of the five strength training principles. (Site 1)

A man has blood type AB and his wife has blood type B. What are the possible blood types for their child

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa

Through what system is glucose delievered to cells for cellular respiration

An element's atomic number is 64. How many protons would an atom of this element have?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How many natural numbers less than 300 are either multiples of 2 or multiples of 3?

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

When the net is folded into the rectangular prism shown beside it, which letters will be on the front and back of the rectangular prism? Question 7 options: The