WonderWoman3882 WonderWoman3882

03-08-2018
Arts

contestada

What national pride is reflected in dutch landscape paintings such as jacob van ruisdael's view of haarlem from the dunes at overveen?

Respuesta :

linds3401 linds3401

04-08-2018

Reclamation of land from the sea.

Hope this helps! <3

Answer Link

Otras preguntas

A chemist reacts magnesium with hydrochloric acid and collects 57.48 mL of the hydrogen gas that is produced by water displacement. If the lab temperature is 24

Three-year Treasury securities currently yield 6%, while 4-year Treasury securities currently yield 6.5%. Assume that the expectations theory holds. What does t

In cells, the activity of enzymes is often regulated by other enzymes or molecules. Why is this necessary?

The kidney is referred to as an excretory organ because it excretes ______ wastes. It is also a major homeostatic organ because it maintains the electrolyte ___

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

The Wayne City Council approved and adopted its budget for 2016. The budget contained the following amounts: Estimated revenues $700,000 Appropriat

Which activity is an example of a long-term goal? A. learning calligraphy B. learning to cook Italian food C. mowing the lawn D. obtaining a graduate degree

How did the Framers deal with the issue of slavery? Why did they choose to take the approach they did?

why did ford want to become involved in conflicts in vietnam and angola

According to the equation below, how many moles of PbO are required to generate 3.88×1023 nitrogen molecules? 3PbO+2NH3→3Pb+N2+3H2O